BARC-PV_1.0_Chr01_6355662_T_C

Marker Overview
NameBARC-PV_1.0_Chr01_6355662_T_C
AliasBARCPV_1.0_Chr01_6355662_T_C
715648278
ss715648278
dbSNP ID715648278
SNP Array ID
BARCBean6K_3:BARC-PV_1.0_Chr01_6355662_T_C
TypeSNP
SNP AllelesT/C
5' Flanking SequenceGTTCAGAACAAATATTTTATACCATCCTCCCTTCAGCACCAACTCCTGCATAGCATGCCT
3' Flanking SequenceCGTTGTGGTTCTGCTATACCACCTAGATGGTTCAGCTGGAAGCATATCAAGCCTTTGACA
SpeciesPhaseolus vulgaris
Publication[view all]
ContactQijian Song
References
External references for this genetic_marker
DatabaseAccession
dbSNP715648278
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BARCPV_1.0_Chr01_6355662_T_CBARCPV_1.0_Chr01_6355662_T_C-22.656Phaseolus vulgarismarker_locus
ss715648278ss715648278Phaseolus vulgarismarker_locus


Contact
NameDetails
Qijian Song
First name:Qijian
Last name:Song
Institution:USDA-ARS
Address:Beltsville, Maryland 20705
Country:United States
Email:Qijian.Song@ars.usda.gov
Last update:Aug 2015
Libraries
Library NameType
BARCBean6K_1SNP_chip
BARCBean6K_3SNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Bean-Stampede/RedHawk-F2LG01N/A22.66BARCPV_1.0_Chr01_6355662_T_C-22.656View
2Bean-CAL96/[MLB-49-89A]-RILLG01N/A26.8ss715648278View
Sequence
>BARC-PV_1.0_Chr01_6355662_T_C ID=BARC-PV_1.0_Chr01_6355662_T_C|Name=BARC-PV_1.0_Chr01_6355662_T_C|organism=Phaseolus vulgaris|type=genetic_marker|length=121bp
GTTCAGAACAAATATTTTATACCATCCTCCCTTCAGCACCAACTCCTGCA
TAGCATGCCTYCGTTGTGGTTCTGCTATACCACCTAGATGGTTCAGCTGG
AAGCATATCAAGCCTTTGACA