Vu_UCR16-2_11711

Marker Overview
NameVu_UCR16-2_11711
dbSNP IDN/A
SNP Array ID
Cowpea iSelect Consortium Assay:2_11711
TypeSNP
SNP AllelesA/G
5' Flanking SequenceATTAATAACAGTTTAATTGAAGAGTGAGGGAAAGTAAATTAACACACTAACACACATTGT
3' Flanking SequenceACATACACCAACTAACTAAATAATTAAAAACAGTGAAAGATGAATCGAAACCTGCGAGAT
SpeciesVigna unguiculata
Publication[view all]
ContactMaria Munoz-Amatriain
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
2_117112_11711-2.99Vigna unguiculatamarker_locus
2_117112_11711-4.81Vigna unguiculatamarker_locus
2_117112_11711-4.88Vigna unguiculatamarker_locus
2_117112_11711-4.87Vigna unguiculatamarker_locus
2_117112_11711-4.806Vigna unguiculatamarker_locus
2_117112_11711Vigna unguiculatamarker_locus


Contact
NameDetails
Maria Munoz-Amatriain
First name:Maria
Last name:Munoz-Amatriain
Institution:University of California, Riverside
Country:United States
Email:maria.munoz-amatriain@ucr.edu
Last update:Oct 2016
Libraries
Library NameType
Cowpea iSelect Consortium AssaySNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cowpea-Tvu-14676/IT84S-2246-RILLG01N/A2.992_11711View
2Cowpea-ZN016/Zhijiang-282-RILLG01N/A4.812_11711View
3Cowpea-UCR_consensus_map-2009LG01N/A4.882_11711View
4Cowpea-UCR_consensus_map-2016LG01N/A4.882_11711View
5Cowpea-CB-27/IT82E-18-RILLG01-1N/A4.872_11711View
6Cowpea-ZN016/Zhijiang-282-RIL-2016LG01N/A4.812_11711View
7Cowpea-CB-27/IT82E-18-F6:8-RILLG05N/A4.872_11711View
8Cowpea-UCR_MAGIC_2018-MAGICLG05N/A4.512_11711View
9Cowpea-524-B/IT84S-2049-F10LG01N/A6.812_11711View
Sequence
>Vu_UCR16-2_11711 ID=Vu_UCR16-2_11711|Name=Vu_UCR16-2_11711|organism=Vigna unguiculata|type=genetic_marker|length=121bp
ATTAATAACAGTTTAATTGAAGAGTGAGGGAAAGTAAATTAACACACTAA
CACACATTGTRACATACACCAACTAACTAAATAATTAAAAACAGTGAAAG
ATGAATCGAAACCTGCGAGAT