Vu_UCR16-2_30247

Marker Overview
NameVu_UCR16-2_30247
dbSNP IDN/A
SNP Array ID
Cowpea iSelect Consortium Assay:2_30247
TypeSNP
SNP AllelesA/C
5' Flanking SequenceTGACAAAAGCCACTTAAATTTGGGTATTTGGAATTTACATACATGTTCGAAACAAAATTG
3' Flanking SequenceCCCAATAAGTCCACAAGAGTACCCATTTGTCTGACTTAAACTAATTCTACCAGATCATAG
SpeciesVigna unguiculata
Publication[view all]
ContactMaria Munoz-Amatriain
Relationships

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Seed coat colorqSDCCL.Sanzi/Vita-7.LG05Vigna unguiculataQTL
Pod tip colorqPTC.Sanzi/Vita-7.LG05Vigna unguiculataQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
2_302472_30247Vigna unguiculatamarker_locus


Contact
NameDetails
Maria Munoz-Amatriain
First name:Maria
Last name:Munoz-Amatriain
Institution:University of California, Riverside
Country:United States
Email:maria.munoz-amatriain@ucr.edu
Last update:Oct 2016
Libraries
Library NameType
Cowpea iSelect Consortium AssaySNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cowpea-UCR_consensus_map-2009LG01N/A02_30247View
2Cowpea-UCR_consensus_map-2016LG01N/A02_30247View
3Cowpea-Sanzi/Vita-7-RILLG01-1N/A02_30247View
4Cowpea-Sanzi/Vita-7-F6:8-RILLG05N/A02_30247View
Sequence
>Vu_UCR16-2_30247 ID=Vu_UCR16-2_30247|Name=Vu_UCR16-2_30247|organism=Vigna unguiculata|type=genetic_marker|length=121bp
TGACAAAAGCCACTTAAATTTGGGTATTTGGAATTTACATACATGTTCGA
AACAAAATTGMCCCAATAAGTCCACAAGAGTACCCATTTGTCTGACTTAA
ACTAATTCTACCAGATCATAG