CcM01841

Name	CcM01841
Genbank ID	FI240815
Type	SSR
Species	Cajanus cajan
Repeat Motif	(AC)8(AT)7(GT)8
Primer 1	CcM01841.Forward: CACCCTTTACTTGCCCCTTT
Primer 2	CcM01841.Reverse: CAAAATTTGTTTCTTCTAATGCTTTT
Product Length	215
Publication	[view all]
Contact	Abhishek Bohra Douglas Cook

Name	Details
Abhishek Bohra	First name: Abhishek Last name: Bohra Title: Researcher Institution: Indian Institute of Pulses Research Address: Crop Improvement DivisionIndian Institute of Pulses ResearchKanpurIndia Country: India Email: abhi.omics@gmail.com Last update: Mar 2017
Douglas Cook	First name: Douglas Last name: Cook Institution: University of California, Davis Country: United States Email: drcook@ucdavis.edu Last update: Mar 2011

Database	Accession
DB:genbank	FI240815

Aligned Feature	Feature Type	Alignment Location
Chr_9-CM003611.1	supercontig	Chr_9-CM003611.1:2609480..2609694 .

Year	Publication
2017	Bohra A, Jha R, Pandey G, Patil PG, Saxena RK, Singh IP, Singh D, Mishra RK, Mishra A, Singh F, Varshney RK, Singh NP. New Hypervariable SSR Markers for Diversity Analysis, Hybrid Purity Testing and Trait Mapping in Pigeonpea [Cajanus cajan (L.) Millspaugh]. Frontiers in plant science. 2017; 8:377.
2011	Bohra A, Dubey A, Saxena RK, Penmetsa RV, Poornima KN, Kumar N, Farmer AD, Srivani G, Upadhyaya HD, Gothalwal R, Ramesh S, Singh D, Saxena K, Kishor PBK, Singh NK, Town CD, May GD, Cook DR, Varshney RK. Analysis of BAC-end sequences (BESs) and development of BES-SSR markers for genetic mapping and hybrid purity assessment in pigeonpea (Cajanus spp.). BMC Plant Biology. 2011; 11:56.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Pigeon_pea-ICPL_88039A/AK_250189R-BC	LG01	N/A	92.6	CcM1841	View