CcM01559

Marker Overview
NameCcM01559
AliasCcM1559
Genbank IDFI233176
TypeSSR
SpeciesCajanus cajan
Repeat Motif(AC)12(AT)8
Primer 1CcM01559.Forward: TGCCAATTTTGACTTGAAAACA
Primer 2CcM01559.Reverse: TGCTTGTTTGGGAATAAGGC
Product Length260
Publication[view all]
ContactDouglas Cook
References
External references for this genetic_marker
DatabaseAccession
DB:genbankFI233176
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ReverseCcM01559.ReverseCajanus cajanprimer
ForwardCcM01559.ForwardCajanus cajanprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CcM1559CcM1559-40.64Cajanus cajanmarker_locus
CcM1559CcM1559-36.8Cajanus cajanmarker_locus


Contact
NameDetails
Douglas Cook
First name:Douglas
Last name:Cook
Institution:University of California, Davis
Country:United States
Email:drcook@ucdavis.edu
Last update:Mar 2011
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pigeon_pea-ICRISAT_consensus_map-2012LG02N/A40.64CcM1559-40.64View
2Pigeon_pea-ICP_8863/ICPL_20097-F2LG02N/A36.8CcM1559-36.8View