CcM02149

Marker Overview
NameCcM02149
AliasCcM2149
Genbank IDFI248494
TypeSSR
SpeciesCajanus cajan
Repeat Motif(TA)22
Primer 1CcM02149.Forward: TGTACAGGGCTGTAGGTTCG
Primer 2CcM02149.Reverse: TCATTTTGACCCTTTTTAGATTCC
Product Length235
Publication[view all]
ContactDouglas Cook
References
External references for this genetic_marker
DatabaseAccession
DB:genbankFI248494
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ReverseCcM02149.ReverseCajanus cajanprimer
ForwardCcM02149.ForwardCajanus cajanprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CcM2149CcM2149-38.82Cajanus cajanmarker_locus
CcM2149CcM2149Cajanus cajanmarker_locus
CcM2149CcM2149-34.5Cajanus cajanmarker_locus


Contact
NameDetails
Douglas Cook
First name:Douglas
Last name:Cook
Institution:University of California, Davis
Country:United States
Email:drcook@ucdavis.edu
Last update:Mar 2011
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pigeon_pea-ICRISAT_consensus_map-2012LG02N/A38.82CcM2149-38.82View
2Pigeon_pea-TTB_7/ICP_7035-F2LG02N/A0CcM2149View
3Pigeon_pea-ICP_8863/ICPL_20097-F2LG02N/A34.5CcM2149-34.5View