A-SSR-0205

Marker Overview
NameA-SSR-0205
AliasASSR-205
Genbank IDN/A
TypeSSR
SpeciesCajanus cajan
Repeat Motif(ATGAAG)11
Primer 1A-SSR-0205.Forward: AGCTGAAGAAAATGAAGCAG
Primer 2A-SSR-0205.Reverse: CCAACTAGCTTTCATCATCAG
Publication[view all]
ContactNagendra Singh
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ReverseA-SSR-0205.ReverseCajanus cajanprimer
ForwardA-SSR-0205.ForwardCajanus cajanprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ASSR205ASSR205-16Cajanus cajanmarker_locus
ASSR205ASSR205-8.1Cajanus cajanmarker_locus


Contact
NameDetails
Nagendra Singh
First name:Nagendra
Last name:Singh
Institution:National Research Centre on Plant Biotechnology
Country:India
Email:nksingh@nrcpb.org
Last update:Oct 2012
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pigeon_pea-NRCPB_consensus_map-2017LG01N/A16ASSR205-16View
2Pigeon_pea-Pusa_Dwarf/HDM04-1-F2:3LG01N/A8.1ASSR205-8.1View