|
Marker Overview
Name | TP291372 |
dbSNP ID | N/A |
Type | SNP |
SNP Alleles | G/A |
5' Flanking Sequence | CTGCAATT |
3' Flanking Sequence | CCTCAAGCTATCCAAATCTTGAATTGCTTGATCTCAGTGGGTATGTATCTGTACC |
Species | Lupinus albus |
Primer 1 | TP291372.Forward: GCGAATGCTTTCTCTTGTTCTTG |
Primer 2 | TP291372.Reverse: ACATACCCACTGAGATCAAGCA |
Product Length | 54 |
Publication | [view all] |
Contact | Michal Ksiazkiewicz
|
Publications
Year | Publication |
2017 | Książkiewicz M, Nazzicari N, Yang H, Nelson MN, Renshaw D, Rychel S, Ferrari B, Carelli M, Tomaszewska M, Stawiński S, Naganowska B, Wolko B, Annicchiarico P. A high-density consensus linkage map of white lupin highlights synteny with narrow-leafed lupin and provides markers tagging key agronomic traits. Scientific reports. 2017 11 10; 7(1):15335. |
2020 | Rychel-Bielska S, Nazzicari N, Plewiński P, Bielski W, Annicchiarico P, Książkiewicz M. Development of PCR-based markers and whole-genome selection model for anthracnose resistance in white lupin (Lupinus albus L.).. Journal of applied genetics. 2020 Sep 23. |
Sequence
>TP291372 ID=TP291372; Name=TP291372; organism=Lupinus albus; type=genetic_marker; length=64bp CTGCAATTRCCTCAAGCTATCCAAATCTTGAATTGCTTGATCTCAGTGGG TATGTATCTGTACC
|