WANR1

Name	WANR1
Genbank ID	N/A
Type	gene marker
Species	Lupinus albus
Primer 1	WANR1.Forward: GAGTCACTTAGAAATAAAGG
Primer 2	WANR1.Reverse: GATCCATGAAGATACATTG
Product Length	190
Publication	[view all]
Contact	Harsh Raman Michal Ksiazkiewicz

Name	Details
Harsh Raman	First name: Harsh Last name: Raman Institution: Wagga Wagga Agricultural Institute Country: Australia Email: harsh.raman@dpi.nsw.gov.au Last update: May 2013
Michal Ksiazkiewicz	First name: Michal Last name: Ksiazkiewicz Institution: Institute of Plant Genetics Polish Academy of Sciences Country: Poland Email: mksi@igr.poznan.pl Last update: Nov 2017

Year	Publication
2013	Vipin CA, Luckett DJ, Harper JD, Ash GJ, Kilian A, Ellwood SR, Phan HT, Raman H. Construction of integrated linkage map of a recombinant inbred line population of white lupin (Lupinus albus L.). Breeding science. 2013 Sep; 63(3):292-300.
2020	Rychel-Bielska S, Nazzicari N, Plewiński P, Bielski W, Annicchiarico P, Książkiewicz M. Development of PCR-based markers and whole-genome selection model for anthracnose resistance in white lupin (Lupinus albus L.).. Journal of applied genetics. 2020 Sep 23.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Lupin-Kiev_Mutant/P27174-RIL-2013	LG17	N/A	55.8	WANR1	View
2	Lupin-Kiev_Mutant/P27174-F8	LG02	N/A	2.48	WANR1	View
3	Lupin-Kiev_Mutant/P27174-RIL-2019	LG02	N/A	1.91	WANR1	View