PsCam000976

Marker Overview
NamePsCam000976
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam000976
TypeSNP
SNP AllelesA/G
5' Flanking SequenceAGTGAGGCAAGTTCATCTTCGCATCCACAAGTGTCTGAAGTGGAACAGGATCTGGGACAG
3' Flanking SequenceTGACAATTCATTCTGAAGAGACTCCCGCTCCTCCGCCTGCAAGTAAATCATCACTGAGGT
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam000976_833_870PsCam000976_833_870Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Ballet_x_Cameor-RILLG01N/A6.2PsCam000976_833_870View
2Pea-Cameor_x_Melrose-RILLG01N/A13.5PsCam000976_833_870View
3Pea-Cerise_x_Cameor-F3LG01N/A10.1PsCam000976_833_870View
4Pea-Champagne_x_Terese-RILLG01N/A13.1PsCam000976_833_870View
5Pea-Consensus_GenoPea_array-2015LG01N/A11.05PsCam000976_833_870View
6Pea-JI296_x_DP-RILLG01N/A8.1PsCam000976_833_870View
7Pea-Kazar_x_Melrose-RILLG01N/A2.5PsCam000976_833_870View
8Pea-Sommette_x_Cameor-RILLG01N/A18.2PsCam000976_833_870View
9Pea-VavD265_x_Cameor-RILLG01N/A10.7PsCam000976_833_870View
Sequence
>PsCam000976 ID=PsCam000976|Name=PsCam000976|organism=Pisum sativum|type=genetic_marker|length=121bp
AGTGAGGCAAGTTCATCTTCGCATCCACAAGTGTCTGAAGTGGAACAGGA
TCTGGGACAGRTGACAATTCATTCTGAAGAGACTCCCGCTCCTCCGCCTG
CAAGTAAATCATCACTGAGGT