PsCam001740

Marker Overview
NamePsCam001740
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam001740
TypeSNP
SNP AllelesT/C
5' Flanking SequenceGGAAAGATACCTGACTCTTTTGCTGAGCTTGATAAAGTGGACTACATGTAAGCGAACAGA
3' Flanking SequenceTGAACCGAACCCGAACGAAACATATTTTTGGATCATCTCTTTGTTGAACATCTCGTATAA
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam001740_1433_1102PsCam001740_1433_1102Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Ballet_x_Cameor-RILLG01N/A5PsCam001740_1433_1102View
2Pea-Cameor_x_Melrose-RILLG01N/A10.8PsCam001740_1433_1102View
3Pea-Champagne_x_Terese-RILLG01N/A11.7PsCam001740_1433_1102View
4Pea-Consensus_GenoPea_array-2015LG01N/A10.3PsCam001740_1433_1102View
5Pea-Kazar_x_Melrose-RILLG01N/A2.1PsCam001740_1433_1102View
6Pea-VavD265_x_Ballet-RILLG01N/A7.6PsCam001740_1433_1102View
Sequence
>PsCam001740 ID=PsCam001740|Name=PsCam001740|organism=Pisum sativum|type=genetic_marker|length=121bp
GGAAAGATACCTGACTCTTTTGCTGAGCTTGATAAAGTGGACTACATGTA
AGCGAACAGAYTGAACCGAACCCGAACGAAACATATTTTTGGATCATCTC
TTTGTTGAACATCTCGTATAA