PsCam001743

Marker Overview
NamePsCam001743
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam001743
TypeSNP
SNP AllelesT/G
5' Flanking SequenceTTATCTTGGTTTTCTTCACCTAGTCATTTCTGAATAACTTGTTTGTACATGCAAAAGAGA
3' Flanking SequenceACAAGTTTGAGAAGATAAAAGATTAATGGGACAAATGGAAACACTTGTGGTTTCTTGAAG
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam001743_1436_3064PsCam001743_1436_3064Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Cameor_x_Melrose-RILLG01N/A8.7PsCam001743_1436_3064View
2Pea-Consensus_GenoPea_array-2015LG01N/A8.4PsCam001743_1436_3064View
3Pea-JI296_x_DP-RILLG01N/A6.4PsCam001743_1436_3064View
4Pea-Kazar_x_Melrose-RILLG01N/A0.1PsCam001743_1436_3064View
5Pea-VavD265_x_Ballet-RILLG01N/A5.1PsCam001743_1436_3064View
6Pea-VavD265_x_Cameor-RILLG01N/A9.8PsCam001743_1436_3064View
Sequence
>PsCam001743 ID=PsCam001743|Name=PsCam001743|organism=Pisum sativum|type=genetic_marker|length=121bp
TTATCTTGGTTTTCTTCACCTAGTCATTTCTGAATAACTTGTTTGTACAT
GCAAAAGAGAKACAAGTTTGAGAAGATAAAAGATTAATGGGACAAATGGA
AACACTTGTGGTTTCTTGAAG