PsCam007118

Marker Overview
NamePsCam007118
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam007118
TypeSNP
SNP AllelesT/C
5' Flanking SequenceGGTCTTGAATGAAGTGGCTTGCCAGATTCTGTTTATTATGTGGCAAACCCAATAATTTTG
3' Flanking SequenceAGCAAATCTAGGCAGGTTTAGAATATTCTCACCAACCAAAACGTAAATGTATCTAT
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam007118_5290_920PsCam007118_5290_920Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Ballet_x_Cameor-RILLG01N/A1.9PsCam007118_5290_920View
2Pea-Cameor_x_Melrose-RILLG01N/A5.7PsCam007118_5290_920View
3Pea-Cerise_x_Cameor-F3LG01N/A4PsCam007118_5290_920View
4Pea-Champagne_x_Terese-RILLG01N/A3PsCam007118_5290_920View
5Pea-China_x_Cameor-RILLG01N/A2.2PsCam007118_5290_920View
6Pea-Consensus_GenoPea_array-2015LG01N/A4.4PsCam007118_5290_920View
7Pea-Kazar_x_Cameor-RILLG01N/A2.9PsCam007118_5290_920View
8Pea-VavD265_x_Ballet-RILLG01N/A1.7PsCam007118_5290_920View
Sequence
>PsCam007118 ID=PsCam007118|Name=PsCam007118|organism=Pisum sativum|type=genetic_marker|length=117bp
GGTCTTGAATGAAGTGGCTTGCCAGATTCTGTTTATTATGTGGCAAACCC
AATAATTTTGYAGCAAATCTAGGCAGGTTTAGAATATTCTCACCAACCAA
AACGTAAATGTATCTAT