PsCam007876

Marker Overview
NamePsCam007876
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam007876
TypeSNP
SNP AllelesT/C
5' Flanking SequenceTGTGAAGGTGACAGACATATACCATGGGGAAGGAGAAAAGGTATCATTCATGGTGAAGTT
3' Flanking SequenceGAGTTTTGGCCGTTGATATGTTTATTATTTTAATGTGTGTCAGTGTTCGAATAAAGTGAT
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam007876_5702_806PsCam007876_5702_806Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Baccara_x_PI180693-RILLG01N/A6.7PsCam007876_5702_806View
2Pea-Consensus_GenoPea_array-2015LG01N/A28.1PsCam007876_5702_806View
3Pea-Kazar_x_Cameor-RILLG01N/A21.1PsCam007876_5702_806View
4Pea-Kazar_x_Melrose-RILLG01N/A13.5PsCam007876_5702_806View
5Pea-VavD265_x_Ballet-RILLG01N/A24.2PsCam007876_5702_806View
6Pea-VavD265_x_Cameor-RILLG01N/A24.5PsCam007876_5702_806View
Sequence
>PsCam007876 ID=PsCam007876|Name=PsCam007876|organism=Pisum sativum|type=genetic_marker|length=121bp
TGTGAAGGTGACAGACATATACCATGGGGAAGGAGAAAAGGTATCATTCA
TGGTGAAGTTYGAGTTTTGGCCGTTGATATGTTTATTATTTTAATGTGTG
TCAGTGTTCGAATAAAGTGAT