PsCam009894

Marker Overview
NamePsCam009894
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam009894
TypeSNP
SNP AllelesA/G
5' Flanking SequenceAACGGCGTCACGAACCAAAACAAAGCTGCAACAAGTAACACAGTCAAACTAGCAGTTAAT
3' Flanking SequenceGAAAAGTAAAACGCAACAAACCCAGGTCCAAAATAAGCTAAGCCAAACGCAGTAGATCCA
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam009894_6639_347PsCam009894_6639_347Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Cameor_x_Melrose-RILLG01N/A32.9PsCam009894_6639_347View
2Pea-Cerise_x_Cameor-F3LG01N/A20.4PsCam009894_6639_347View
3Pea-Champagne_x_Terese-RILLG01N/A33.6PsCam009894_6639_347View
4Pea-Consensus_GenoPea_array-2015LG01N/A34.6PsCam009894_6639_347View
5Pea-Kazar_x_Melrose-RILLG01N/A16.9PsCam009894_6639_347View
Sequence
>PsCam009894 ID=PsCam009894|Name=PsCam009894|organism=Pisum sativum|type=genetic_marker|length=121bp
AACGGCGTCACGAACCAAAACAAAGCTGCAACAAGTAACACAGTCAAACT
AGCAGTTAATRGAAAAGTAAAACGCAACAAACCCAGGTCCAAAATAAGCT
AAGCCAAACGCAGTAGATCCA