PsCam012884

Marker Overview
NamePsCam012884
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam012884
TypeSNP
SNP AllelesT/C
5' Flanking SequenceAGGAACCGCGAGTTCTATGAAGAATGGTTGGTTTTACACCGGTGATGTTGGAGTGATGCA
3' Flanking SequenceGAGGATGGATATTTGGAGATTAAAGATAGGTCAAAGGATGTGATTATCAGTGGCGGTGAG
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam012884_8689_1547PsCam012884_8689_1547Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Cameor_x_Melrose-RILLG01N/A32.5PsCam012884_8689_1547View
2Pea-Consensus_GenoPea_array-2015LG01N/A32.6PsCam012884_8689_1547View
3Pea-JI296_x_DP-RILLG01N/A29PsCam012884_8689_1547View
4Pea-Kazar_x_Melrose-RILLG01N/A16PsCam012884_8689_1547View
5Pea-VavD265_x_Ballet-RILLG01N/A27.1PsCam012884_8689_1547View
6Pea-VavD265_x_Cameor-RILLG01N/A28.5PsCam012884_8689_1547View
7Pea-002067/Reward-F8-RILLG01N/A122.4PsCam012884_8689_1547View
Sequence
>PsCam012884 ID=PsCam012884|Name=PsCam012884|organism=Pisum sativum|type=genetic_marker|length=121bp
AGGAACCGCGAGTTCTATGAAGAATGGTTGGTTTTACACCGGTGATGTTG
GAGTGATGCAYGAGGATGGATATTTGGAGATTAAAGATAGGTCAAAGGAT
GTGATTATCAGTGGCGGTGAG