PsCam013537

Marker Overview
NamePsCam013537
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam013537
TypeSNP
SNP AllelesA/G
5' Flanking SequenceAACAGCGGCCGATTGAACTATAAGATTGGCACCGGAATCGGAATCAGCGTTTGCTTCAGC
3' Flanking SequenceAGAGCAACGGCGACGGCGGGAGCGACTCCGAGCTTGATGTACGAGAGTTTCTTGGTACGG
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam013537_9195_822PsCam013537_9195_822Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Cameor_x_Melrose-RILLG01N/A3.9PsCam013537_9195_822View
2Pea-Champagne_x_Terese-RILLG01N/A2.3PsCam013537_9195_822View
3Pea-Consensus_GenoPea_array-2015LG01N/A2.9PsCam013537_9195_822View
4Pea-JI296_x_DP-RILLG01N/A2.5PsCam013537_9195_822View
5Pea-Kazar_x_Cameor-RILLG01N/A1.5PsCam013537_9195_822View
Sequence
>PsCam013537 ID=PsCam013537|Name=PsCam013537|organism=Pisum sativum|type=genetic_marker|length=121bp
AACAGCGGCCGATTGAACTATAAGATTGGCACCGGAATCGGAATCAGCGT
TTGCTTCAGCRAGAGCAACGGCGACGGCGGGAGCGACTCCGAGCTTGATG
TACGAGAGTTTCTTGGTACGG