PsCam016550

Marker Overview
NamePsCam016550
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam016550
TypeSNP
SNP AllelesT/C
5' Flanking SequenceATTGAAACAGAGAACTCGGGATCTCTATCAAGTGAATATGATTCTTGATAATTTGCCTGT
3' Flanking SequenceATGAGGTTTGCTAGTCAAAATGGGGTGAAAATTCAGTGGACGGGGTTTCCTATTGGGTAC
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam016550_10354_911PsCam016550_10354_911Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Cameor_x_Melrose-RILLG01N/A0.8PsCam016550_10354_911View
2Pea-China_x_Cameor-RILLG01N/A0PsCam016550_10354_911View
3Pea-Consensus_GenoPea_array-2015LG01N/A0.8PsCam016550_10354_911View
Sequence
>PsCam016550 ID=PsCam016550|Name=PsCam016550|organism=Pisum sativum|type=genetic_marker|length=121bp
ATTGAAACAGAGAACTCGGGATCTCTATCAAGTGAATATGATTCTTGATA
ATTTGCCTGTYATGAGGTTTGCTAGTCAAAATGGGGTGAAAATTCAGTGG
ACGGGGTTTCCTATTGGGTAC