PsCam035677

Marker Overview
NamePsCam035677
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam035677
TypeSNP
SNP AllelesA/G
5' Flanking SequenceAGGTATCCAAAACAAACAGTGCATGAAAAATCAAACAAGTATTAACACTAAAAAAATCAA
3' Flanking SequenceGTATTGACTGGCAAGAAAAGACATCTCATGATGTTTCCGTATTGCACAGAATCAACCAAA
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam035677_20851_182PsCam035677_20851_182Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Cameor_x_Melrose-RILLG01N/A5.7PsCam035677_20851_182View
2Pea-Champagne_x_Terese-RILLG01N/A3PsCam035677_20851_182View
3Pea-China_x_Cameor-RILLG01N/A2.2PsCam035677_20851_182View
4Pea-Consensus_GenoPea_array-2015LG01N/A3.4PsCam035677_20851_182View
5Pea-JI296_x_DP-RILLG01N/A2.5PsCam035677_20851_182View
6Pea-Kazar_x_Cameor-RILLG01N/A2.2PsCam035677_20851_182View
Sequence
>PsCam035677 ID=PsCam035677|Name=PsCam035677|organism=Pisum sativum|type=genetic_marker|length=121bp
AGGTATCCAAAACAAACAGTGCATGAAAAATCAAACAAGTATTAACACTA
AAAAAATCAARGTATTGACTGGCAAGAAAAGACATCTCATGATGTTTCCG
TATTGCACAGAATCAACCAAA