PsCam037629

Marker Overview
NamePsCam037629
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam037629
TypeSNP
SNP AllelesT/C
5' Flanking SequenceAAGTGGGACCGTTGATTTGGAGGTTGTTTTGGCGCCAGAAACTATGGCGGGGCTTGAGAG
3' Flanking SequenceGATGCGGAGTTTATGGCTTATGCGACGAGGCAGTTGTAATACGTGTCGTGTTTTGGTGTT
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam037629_22704_1591PsCam037629_22704_1591Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Baccara_x_PI180693-RILLG01N/A3.8PsCam037629_22704_1591View
2Pea-Cameor_x_Melrose-RILLG01N/A26.7PsCam037629_22704_1591View
3Pea-Consensus_GenoPea_array-2015LG01N/A24.8PsCam037629_22704_1591View
4Pea-JI296_x_DP-RILLG01N/A21.5PsCam037629_22704_1591View
5Pea-Kazar_x_Cameor-RILLG01N/A18.6PsCam037629_22704_1591View
6Pea-Kazar_x_Melrose-RILLG01N/A10.9PsCam037629_22704_1591View
7Pea-Sommette_x_Cameor-RILLG01N/A28.5PsCam037629_22704_1591View
8Pea-002067/Reward-F8-RILLG01N/A134.87PsCam037629_22704_1591View
Sequence
>PsCam037629 ID=PsCam037629|Name=PsCam037629|organism=Pisum sativum|type=genetic_marker|length=121bp
AAGTGGGACCGTTGATTTGGAGGTTGTTTTGGCGCCAGAAACTATGGCGG
GGCTTGAGAGYGATGCGGAGTTTATGGCTTATGCGACGAGGCAGTTGTAA
TACGTGTCGTGTTTTGGTGTT