PsCam038031

Marker Overview
NamePsCam038031
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam038031
TypeSNP
SNP AllelesT/G
5' Flanking SequenceTTTGTGAGTGTTAAGGTAAATTGAGTGAAGTGAGAGAGTGAACAGAAAGAACGAAGGAGC
3' Flanking SequenceTGCATGAAGGAGTGAAAGAGGAAGAAAGTTGGTATAAGCTTAAGCTTAAAAGTGAGGATT
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam038031_23083_1202PsCam038031_23083_1202Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-China_x_Cameor-RILLG01N/A37.4PsCam038031_23083_1202View
2Pea-Consensus_GenoPea_array-2015LG01N/A33.5PsCam038031_23083_1202View
3Pea-Kazar_x_Cameor-RILLG01N/A24.6PsCam038031_23083_1202View
4Pea-Kazar_x_Melrose-RILLG01N/A16.9PsCam038031_23083_1202View
Sequence
>PsCam038031 ID=PsCam038031|Name=PsCam038031|organism=Pisum sativum|type=genetic_marker|length=121bp
TTTGTGAGTGTTAAGGTAAATTGAGTGAAGTGAGAGAGTGAACAGAAAGA
ACGAAGGAGCKTGCATGAAGGAGTGAAAGAGGAAGAAAGTTGGTATAAGC
TTAAGCTTAAAAGTGAGGATT