PsCam038341

Marker Overview
NamePsCam038341
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam038341
TypeSNP
SNP AllelesT/C
5' Flanking SequenceTTTTTGGCAGGGACACCGGTTTTTGAATTTTCTTCTAGCATGTATGGTGTTTGCATTTGT
3' Flanking SequenceATATCATGGCTTTTTCACTTTAATGTCCCCTCTTGAATTCTTATGTAACTTGAAGATGAA
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam038341_23379_1876PsCam038341_23379_1876Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Cameor_x_Melrose-RILLG01N/A27.3PsCam038341_23379_1876View
2Pea-Champagne_x_Terese-RILLG01N/A26.2PsCam038341_23379_1876View
3Pea-Consensus_GenoPea_array-2015LG01N/A25.8PsCam038341_23379_1876View
4Pea-JI296_x_DP-RILLG01N/A24PsCam038341_23379_1876View
5Pea-Kazar_x_Cameor-RILLG01N/A18.6PsCam038341_23379_1876View
6Pea-Kazar_x_Melrose-RILLG01N/A13.1PsCam038341_23379_1876View
7Pea-VavD265_x_Ballet-RILLG01N/A22.4PsCam038341_23379_1876View
8Pea-VavD265_x_Cameor-RILLG01N/A21.8PsCam038341_23379_1876View
Sequence
>PsCam038341 ID=PsCam038341|Name=PsCam038341|organism=Pisum sativum|type=genetic_marker|length=121bp
TTTTTGGCAGGGACACCGGTTTTTGAATTTTCTTCTAGCATGTATGGTGT
TTGCATTTGTYATATCATGGCTTTTTCACTTTAATGTCCCCTCTTGAATT
CTTATGTAACTTGAAGATGAA