PsCam042235

Marker Overview
NamePsCam042235
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam042235
TypeSNP
SNP AllelesA/G
5' Flanking SequenceCTACACCTATACTCACGGGGCAATAGAAAATAAATGGAAACTTCCAAACTAATTGCCATT
3' Flanking SequenceTTAAATTTTTACCAGCAAATTGAAGAAAATGACCAGACATCTCTTACATTTTCTTTATTT
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam042235_26326_3584PsCam042235_26326_3584Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Champagne_x_Terese-RILLG01N/A27.1PsCam042235_26326_3584View
2Pea-China_x_Cameor-RILLG01N/A27.3PsCam042235_26326_3584View
3Pea-Consensus_GenoPea_array-2015LG01N/A24.4PsCam042235_26326_3584View
4Pea-Kazar_x_Melrose-RILLG01N/A10.9PsCam042235_26326_3584View
5Pea-Sommette_x_Cameor-RILLG01N/A28.5PsCam042235_26326_3584View
6Pea-VavD265_x_Ballet-RILLG01N/A18.8PsCam042235_26326_3584View
7Pea-VavD265_x_Cameor-RILLG01N/A20.6PsCam042235_26326_3584View
8Pea-002067/Reward-F8-RILLG01N/A135.27PsCam042235_26326_3584View
Sequence
>PsCam042235 ID=PsCam042235|Name=PsCam042235|organism=Pisum sativum|type=genetic_marker|length=121bp
CTACACCTATACTCACGGGGCAATAGAAAATAAATGGAAACTTCCAAACT
AATTGCCATTRTTAAATTTTTACCAGCAAATTGAAGAAAATGACCAGACA
TCTCTTACATTTTCTTTATTT