PsCam044840

Marker Overview
NamePsCam044840
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam044840
TypeSNP
SNP AllelesT/C
5' Flanking SequenceCAGAAAAGTTGCAGAAGGTGTTCTGCGGAAATACGGGGCCGTAGTTACTTGTGTTGAGGG
3' Flanking SequenceGGTAAGGCTGCTCTAAAGATGCTTAAACCACCGCATAATTTTGATGCTTGTTTCATGGAT
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam044840_28591_4158PsCam044840_28591_4158Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Ballet_x_Cameor-RILLG01N/A0.5PsCam044840_28591_4158View
2Pea-Champagne_x_Terese-RILLG01N/A2.3PsCam044840_28591_4158View
3Pea-China_x_Cameor-RILLG01N/A0.9PsCam044840_28591_4158View
4Pea-Consensus_GenoPea_array-2015LG01N/A2.5PsCam044840_28591_4158View
5Pea-VavD265_x_Ballet-RILLG01N/A0PsCam044840_28591_4158View
Sequence
>PsCam044840 ID=PsCam044840|Name=PsCam044840|organism=Pisum sativum|type=genetic_marker|length=121bp
CAGAAAAGTTGCAGAAGGTGTTCTGCGGAAATACGGGGCCGTAGTTACTT
GTGTTGAGGGYGGTAAGGCTGCTCTAAAGATGCTTAAACCACCGCATAAT
TTTGATGCTTGTTTCATGGAT