PsCam045130

Marker Overview
NamePsCam045130
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam045130
TypeSNP
SNP AllelesA/G
5' Flanking SequenceCAAGTTGCTTCCTCCGTCTCACAAGATCCAAGGGAAATGTTGCTGCATATAGGATAAAAA
3' Flanking SequenceAATAATTGAACCATATCTATTCTCGTTTAAAAGAG
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam045130_28850_2259PsCam045130_28850_2259Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Baccara_x_PI180693-RILLG01N/A3.9PsCam045130_28850_2259View
2Pea-Ballet_x_Cameor-RILLG01N/A23.7PsCam045130_28850_2259View
3Pea-Cameor_x_Melrose-RILLG01N/A27.3PsCam045130_28850_2259View
4Pea-Cerise_x_Cameor-F3LG01N/A17.1PsCam045130_28850_2259View
5Pea-China_x_Cameor-RILLG01N/A30.6PsCam045130_28850_2259View
6Pea-Consensus_GenoPea_array-2015LG01N/A26.1PsCam045130_28850_2259View
7Pea-Kazar_x_Melrose-RILLG01N/A13.5PsCam045130_28850_2259View
8Pea-VavD265_x_Cameor-RILLG01N/A22.4PsCam045130_28850_2259View
Sequence
>PsCam045130 ID=PsCam045130|Name=PsCam045130|organism=Pisum sativum|type=genetic_marker|length=96bp
CAAGTTGCTTCCTCCGTCTCACAAGATCCAAGGGAAATGTTGCTGCATAT
AGGATAAAAARAATAATTGAACCATATCTATTCTCGTTTAAAAGAG