PsCam046540

Marker Overview
NamePsCam046540
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam046540
TypeSNP
SNP AllelesA/G
5' Flanking SequenceTCCTGTGGCTGAGGACATGTTCCACTGGCAAGCCACGATCATGGGACCGTCTGATAGTCC
3' Flanking SequenceTATACAGGCGGTGTTTTCCTGGTTTCGATACATTTTCCTCCTGACTATCCTTTCAAGCCA
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam046540_29945_113PsCam046540_29945_113Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Baccara_x_PI180693-RILLG01N/A12PsCam046540_29945_113View
2Pea-Ballet_x_Cameor-RILLG01N/A32.5PsCam046540_29945_113View
3Pea-Cameor_x_Melrose-RILLG01N/A32.9PsCam046540_29945_113View
4Pea-Cerise_x_Cameor-F3LG01N/A20.4PsCam046540_29945_113View
5Pea-Consensus_GenoPea_array-2015LG01N/A33.5PsCam046540_29945_113View
6Pea-Kazar_x_Melrose-RILLG01N/A16.9PsCam046540_29945_113View
7Pea-VavD265_x_Ballet-RILLG01N/A29PsCam046540_29945_113View
Sequence
>PsCam046540 ID=PsCam046540|Name=PsCam046540|organism=Pisum sativum|type=genetic_marker|length=121bp
TCCTGTGGCTGAGGACATGTTCCACTGGCAAGCCACGATCATGGGACCGT
CTGATAGTCCRTATACAGGCGGTGTTTTCCTGGTTTCGATACATTTTCCT
CCTGACTATCCTTTCAAGCCA