PsCam048914

Marker Overview
NamePsCam048914
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam048914
TypeSNP
SNP AllelesT/C
5' Flanking SequenceTCGCGGCCTTTTGATCTCTCTATCTTTGGTGCGTTTCTCGTTCAAATTGCGAAAGCCTTC
3' Flanking SequenceTTGGCACAAACGAATTGTCTCTGAATGATAGCTCCGTCGCGACGTGAACGACGGGAGGAG
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam048914_31566_1690PsCam048914_31566_1690Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Cerise_x_Cameor-F3LG01N/A0PsCam048914_31566_1690View
2Pea-Consensus_GenoPea_array-2015LG01N/A0PsCam048914_31566_1690View
3Pea-Kazar_x_Cameor-RILLG01N/A0PsCam048914_31566_1690View
4Pea-Sommette_x_Cameor-RILLG01N/A0PsCam048914_31566_1690View
5Pea-VavD265_x_Ballet-RILLG01N/A0PsCam048914_31566_1690View
6Pea-VavD265_x_Cameor-RILLG01N/A0PsCam048914_31566_1690View
7Pea-INRAE_Frost_damage-2020LG01N/A0PsCam048914_31566_1690View
8Pea-002067/Reward-F8-RILLG01N/A205.1PsCam048914_31566_1690View
Sequence
>PsCam048914 ID=PsCam048914|Name=PsCam048914|organism=Pisum sativum|type=genetic_marker|length=121bp
TCGCGGCCTTTTGATCTCTCTATCTTTGGTGCGTTTCTCGTTCAAATTGC
GAAAGCCTTCYTTGGCACAAACGAATTGTCTCTGAATGATAGCTCCGTCG
CGACGTGAACGACGGGAGGAG