PsCam048927

Marker Overview
NamePsCam048927
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam048927
TypeSNP
SNP AllelesA/C
5' Flanking SequenceAGTAGTAGAATTCTTTTGGTTCTGACTTCCATCATCAGTTTTAGCTGAAGACGAGAACAA
3' Flanking SequenceGCTCTTCCATCCACCTTCGAATTCTGTTCAACACAATCACATTAAGGATCAAAAACATTA
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam048927_31579_257PsCam048927_31579_257Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Baccara_x_PI180693-RILLG01N/A12PsCam048927_31579_257View
2Pea-Ballet_x_Cameor-RILLG01N/A31.8PsCam048927_31579_257View
3Pea-Cameor_x_Melrose-RILLG01N/A32.9PsCam048927_31579_257View
4Pea-Champagne_x_Terese-RILLG01N/A32.1PsCam048927_31579_257View
5Pea-Consensus_GenoPea_array-2015LG01N/A33PsCam048927_31579_257View
6Pea-Kazar_x_Melrose-RILLG01N/A16.5PsCam048927_31579_257View
7Pea-VavD265_x_Cameor-RILLG01N/A28.9PsCam048927_31579_257View
Sequence
>PsCam048927 ID=PsCam048927|Name=PsCam048927|organism=Pisum sativum|type=genetic_marker|length=121bp
AGTAGTAGAATTCTTTTGGTTCTGACTTCCATCATCAGTTTTAGCTGAAG
ACGAGAACAAMGCTCTTCCATCCACCTTCGAATTCTGTTCAACACAATCA
CATTAAGGATCAAAAACATTA