PsCam050293

Marker Overview
NamePsCam050293
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam050293
TypeSNP
SNP AllelesA/G
5' Flanking SequenceAAAGAAATGGAACGGTAGACACATTTTATAGCATCTCCGTTTCAAAATTTGAACAAAATC
3' Flanking SequenceAACATGTGTTCGGTGTTAGACACATCTCCAATCGGTGTTTACGTATCAGTGTCATGTCTG
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam050293_32884_1383PsCam050293_32884_1383Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-China_x_Cameor-RILLG01N/A37.4PsCam050293_32884_1383View
2Pea-Consensus_GenoPea_array-2015LG01N/A33.5PsCam050293_32884_1383View
3Pea-Kazar_x_Cameor-RILLG01N/A24.6PsCam050293_32884_1383View
4Pea-Kazar_x_Melrose-RILLG01N/A16.9PsCam050293_32884_1383View
Sequence
>PsCam050293 ID=PsCam050293|Name=PsCam050293|organism=Pisum sativum|type=genetic_marker|length=121bp
AAAGAAATGGAACGGTAGACACATTTTATAGCATCTCCGTTTCAAAATTT
GAACAAAATCRAACATGTGTTCGGTGTTAGACACATCTCCAATCGGTGTT
TACGTATCAGTGTCATGTCTG