PsCam057122

Marker Overview
NamePsCam057122
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam057122
TypeSNP
SNP AllelesA/G
5' Flanking SequenceGAAATGTTGATGATTGTAACGTCAGGAACATAAGGTTACTCTGTTGATTATATATTTCAT
3' Flanking SequenceATCTTGATTAAAGGAATTATAGGTTTGTTTAGGTTGTGATTCCTGGAACGTGGTCTTGTT
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam057122_37780_406PsCam057122_37780_406Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Baccara_x_PI180693-RILLG01N/A0.3PsCam057122_37780_406View
2Pea-China_x_Cameor-RILLG04N/A110.9PsCam057122_37780_406View
3Pea-JI296_x_DP-RILLG01N/A16.5PsCam057122_37780_406View
4Pea-Kazar_x_Melrose-RILLG01N/A13.5PsCam057122_37780_406View
5Pea-Sommette_x_Cameor-RILLG04N/A113.2PsCam057122_37780_406View
Sequence
>PsCam057122 ID=PsCam057122|Name=PsCam057122|organism=Pisum sativum|type=genetic_marker|length=121bp
GAAATGTTGATGATTGTAACGTCAGGAACATAAGGTTACTCTGTTGATTA
TATATTTCATRATCTTGATTAAAGGAATTATAGGTTTGTTTAGGTTGTGA
TTCCTGGAACGTGGTCTTGTT