Vu_UCR15-2_11663

Marker Overview
NameVu_UCR15-2_11663
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
5' Flanking SequenceGCAAATTCTGTCTTGGCTATGGCTATTCCTGGTTTGGCTCTACTACCTTCAAAGTTGAAC
3' Flanking SequenceTTTTATCTGAGGCCAGTCTGATAAGTCATGCGCTGCTCTTATGCTACATTGAGAACCGTT
SpeciesVigna unguiculata
Publication[view all]
ContactBao-Lam Huynh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
2_116632_11663Vigna unguiculatamarker_locus


Contact
NameDetails
Bao-Lam Huynh
First name:Bao-Lam
Last name:Huynh
Institution:University of California Riverside
Country:United States
Email:baolam.huynh@ucr.edu
Last update:Oct 2015
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cowpea-UCR_MAGIC_2018-MAGICLG05N/A1.212_11663View
2Cowpea-ZN016/Zhijiang-282-RIL-2016LG01N/A02_11663View
3Cowpea-ZN016/Zhijiang-282-RILLG01N/A02_11663View
Sequence
>Vu_UCR15-2_11663 ID=Vu_UCR15-2_11663|Name=Vu_UCR15-2_11663|organism=Vigna unguiculata|type=genetic_marker|length=121bp
GCAAATTCTGTCTTGGCTATGGCTATTCCTGGTTTGGCTCTACTACCTTC
AAAGTTGAACYTTTTATCTGAGGCCAGTCTGATAAGTCATGCGCTGCTCT
TATGCTACATTGAGAACCGTT