ye_TRINITY_DN128426_c0_g1:409-509

Marker Overview
Nameye_TRINITY_DN128426_c0_g1:409-509
Genbank IDN/A
SNP Array ID
Faba_bean_130K:ye_TRINITY_DN128426_c0_g1:409-509
TypeTNGS
Probe 1ye_TRINITY_DN128426_c0_g1:409-509.Probe: GCAACCTGCTGGAGACATGTCACTTCCAGAGCTTCTGGGCCAGTCTAGAGGAGAACAGAGATCTGATTGATGGAATCACAGGATTTGAGGATTCAGTGCG
SpeciesVicia faba
Publication[view all]
ContactXuxiao Zong
Relationships

The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
Probeye_TRINITY_DN128426_c0_g1:409-509.ProbeVicia fabaprobe


Contact
NameDetails
Xuxiao Zong
First name:Xuxiao
Last name:Zong
Institution:Chinese Academy of Agricultural Science
Address:Institute of Crop Sciences, The National Key Facility for Crop Gene Resources and Genetic Improvement, Chinese Academy of Agricultural Sciences, Beijing 100081, China
Country:China
Email:zongxx@mail.caas.net.cn
Last update:Mar 2014
Libraries
Library NameType
Faba_bean_130KSNP_chip