AZ07_26.5M5

Name	AZ07_26.5M5
Genbank ID	N/A
Type	SSR
Species	Vigna angularis
Repeat Motif	(AT)13
Primer 1	AZ07_26.5M5.Forward: GGGCGCCAAATAGATGAATA
Primer 2	AZ07_26.5M5.Reverse: GTGATCTACACGCCTCACGA
Publication	[view all]
Contact	Masahiko Mori

Name	Details
Masahiko Mori	First name: Masahiko Last name: Mori Institution: Obihiro University of Agriculture and Veterinary Medicine Country: Japan Email: mmmori@obihiro.ac.jp Last update: Dec 2020

Year	Publication
2021	Mori M, Maki K, Kawahata T, Kawahara D, Kato Y, Yoshida T, Nagasawa H, Sato H, Nagano AJ, Bethke PC, Kato K. Mapping of QTLs controlling epicotyl length in adzuki bean (Vigna angularis). Breeding Science. 2021; 71:208-216.