WSU21_1292

Marker Overview
NameWSU21_1292
dbSNP IDN/A
TypeSNP
SNP AllelesA/T
SpeciesPisum sativum
Primer 1WSU21_1292.Extension: TCAACCACCATGAACCA
Primer 2WSU21_1292.Forward: ACGTTGGATGTATGATCCTCCATGAGTCCC
Primer 3WSU21_1292.Reverse: ACGTTGGATGGACTTTCTCTGGTCAACCAC
Product Length99
Publication[view all]
ContactAmit Dhingra
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardWSU21_1292.ForwardPisum sativumprimer
ReverseWSU21_1292.ReversePisum sativumprimer
ExtensionWSU21_1292.ExtensionPisum sativumprimer


Contact
NameDetails
Amit Dhingra
First name:Amit
Last name:Dhingra
Institution:Washington State University
Country:United States
Email:adhingra@wsu.edu
Last update:Aug 2021