PAS_077C13_3

Marker Overview
NamePAS_077C13_3
Genbank IDN/A
TypeCAPS
SpeciesLupinus angustifolius
Primer 1PAS_077C13_3.Forward: AGCTTTCTTCTTCCATAGCAGT
Primer 2PAS_077C13_3.Reverse: TTGGCTGAAAATCTATAAGCTG
Publication[view all]
ContactMichal Ksiazkiewicz
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardPAS_077C13_3.ForwardLupinus angustifoliusprimer
ReversePAS_077C13_3.ReverseLupinus angustifoliusprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
077C13_3077C13_3Lupinus angustifoliusmarker_locus


Contact
NameDetails
Michal Ksiazkiewicz
First name:Michal
Last name:Ksiazkiewicz
Institution:Institute of Plant Genetics Polish Academy of Sciences
Country:Poland
Email:mksi@igr.poznan.pl
Last update:Nov 2017
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Lupin-83A:476/P27255-RIL-2010LG10N/A67.9077C13_3View