PAS_083C06_3

Marker Overview
NamePAS_083C06_3
Genbank IDN/A
TypeCAPS
SpeciesLupinus angustifolius
Primer 1PAS_083C06_3.Forward: AAGCTTTCACTCCCAAGTGCTAC
Primer 2PAS_083C06_3.Reverse: CTAAATTAGAACTTATGGCAAAAGGA
Publication[view all]
ContactMichal Ksiazkiewicz
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardPAS_083C06_3.ForwardLupinus angustifoliusprimer
ReversePAS_083C06_3.ReverseLupinus angustifoliusprimer


Contact
NameDetails
Michal Ksiazkiewicz
First name:Michal
Last name:Ksiazkiewicz
Institution:Institute of Plant Genetics Polish Academy of Sciences
Country:Poland
Email:mksi@igr.poznan.pl
Last update:Nov 2017