PAS_076K16_5

Marker Overview
NamePAS_076K16_5
Genbank IDN/A
TypeCAPS
SpeciesLupinus angustifolius
Primer 1PAS_076K16_5.Forward: GACACCGTGAATGGCTTGTA
Primer 2PAS_076K16_5.Reverse: TGATTCTCCAAACTTCCTTGTG
Publication[view all]
ContactMichal Ksiazkiewicz
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardPAS_076K16_5.ForwardLupinus angustifoliusprimer
ReversePAS_076K16_5.ReverseLupinus angustifoliusprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
076K16_5076K16_5Lupinus angustifoliusmarker_locus


Contact
NameDetails
Michal Ksiazkiewicz
First name:Michal
Last name:Ksiazkiewicz
Institution:Institute of Plant Genetics Polish Academy of Sciences
Country:Poland
Email:mksi@igr.poznan.pl
Last update:Nov 2017
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Lupin-83A:476/P27255-RIL-2010LG06N/A41076K16_5View