VUIn855

Marker Overview
NameVUIn855
Genbank IDN/A
TypeIndel
SpeciesVigna unguiculata
Primer 1VUIn855.Forward: TCAACAAAGTCTCAGCAACT
Primer 2VUIn855.Reverse: GATGTGTTGTGTCTGCAAAA
Publication[view all]
ContactXin Chen
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardVUIn855.ForwardVigna unguiculataprimer
ReverseVUIn855.ReverseVigna unguiculataprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
VUIn855VUIn855Vigna unguiculatamarker_locus


Contact
NameDetails
Xin Chen
First name:Xin
Last name:Chen
Institution:Jiangsu Academy of Agricultural Sciences
Country:China
Email:cx@jaas.ac.cn
Last update:Jul 2020
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Vigna-IT97K49935-REFVu01N/A38925557VUIn855View