HO065507

EST Overview
NameHO065507
Unique NameHO065507
TypeEST
OrganismCicer arietinum (chickpea)
Sequence length407
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Cicer arietinum unigene v12010-12-27
InterProScan analysis for Cicer arietinum unigene v12010-12-29
Libraries
Library NameType
LIBEST_026412 Chickpea drought stressed cDNA SSH library AS1cdna_library
Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Cicer arietinum unigene v1Cicer arietinum unigene v1EST
InterPro
Analysis Name: InterProScan analysis for Cicer arietinum unigene v1
Date Performed: 2010-12-29
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 36..56
score: NAcoord: 87..101
score

Properties
Property NameValue
Singlet in analysisCicer arietinum unigene v1
Sequences
The following sequences are available for this feature:

EST sequence

>HO065507 ID=HO065507|Name=HO065507|organism=Cicer arietinum|type=EST|length=407bp
TAGCGTGGTCGCGGCCGAGGTACGCGGGAGCCCAATATATTTACACAACA
ACCCATGTATGCACCGCCATTTGCGGTCAAAACCAAATGACATTTGATTC
GAGTTCACCTTTCCAACAGATGCAGCCACCTCCACAACCTATCTTTCAGG
CACAACAGGGTTTTCCACCTTCGGAATTGCAGTCAGACAGGAACCCGAAC
TTGCATCCCAGTTCTATTCCTGGCAACCCCTCTCAATTTCATCCAGGTTC
ATCTGCTAGTCGAGGGAGGCCAACATTTCGTGGCGGCGGTAGGAGAGGGT
GGCGACCTACTAAGTGAAGGTTATTGTTTGATTTATTAACATTGAAATGA
TCGGTCGAGTTGGGCCCATTCTGCAAGGGATTGTACCTGCCCGGGCGGCC
GCTCGAA
back to top