GR395315

EST Overview
NameGR395315
Unique NameGR395315
TypeEST
OrganismCicer arietinum (chickpea)
Sequence length139
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Cicer arietinum unigene v12010-12-27
Libraries
Library NameType
LIBEST_024781 ICC4958 dehydration stressed root cDNA librarycdna_library
Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Cicer arietinum unigene v1Cicer arietinum unigene v1EST
Properties
Property NameValue
Singlet in analysisCicer arietinum unigene v1
Sequences
The following sequences are available for this feature:

EST sequence

>GR395315 ID=GR395315|Name=GR395315|organism=Cicer arietinum|type=EST|length=139bp
TCTTTTTTCTTTTTTCCTCCCTCTTTTTTAAGAAAACTGTCTTTCATAAG
CATTAATTTATTTAATTTTTACCGACAGAGGGAAATTCCAAGACCTGAAA
TGTCCCATTTGAGGAAACAAGGGAAAAATCCACCCCAAA
back to top