GO660520

EST Overview
NameGO660520
Unique NameGO660520
TypeEST
OrganismCicer arietinum (chickpea)
Sequence length100
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Cicer arietinum unigene v12010-12-27
Homology Analysis: Cicer arietinum unigene v1 vs TAIR 10 peptide2011-02-03
Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Cicer arietinum unigene v1Cicer arietinum unigene v1EST
Homology
BLAST of GO660520 vs. TAIR peptide
Match: AT1G71440.1 (| Symbols: PFI, TFC E | tubulin folding cofactor E / Pfifferling (PFI) | chr1:26921271-26924373 REVERSE LENGTH=531)

HSP 1 Score: 53.5286 bits (127), Expect = 3.036e-8
Identity = 25/28 (89.29%), Postives = 26/28 (92.86%), Query Frame = 1
Query:   10 TNESFIIGQRVHSLNDSRRVGTVKYTQD 93
            +NESFIIGQRVHSLNDSRRVGTVKY  D
Sbjct:    6 SNESFIIGQRVHSLNDSRRVGTVKYVGD 33          
The following BLAST results are available for this feature:
Homology Analysis: Cicer arietinum unigene v1 vs TAIR 10 peptide
Analysis Date: 2011-02-03 (Homology Analysis: Cicer arietinum unigene v1 vs TAIR 10 peptide)
Total hits: 1
Match NameE-valueIdentityDescription
AT1G71440.13.036e-889.29| Symbols: PFI, TFC E | tubulin folding cofactor E... [more]
back to top
Properties
Property NameValue
Singlet in analysisCicer arietinum unigene v1
Sequences
The following sequences are available for this feature:

EST sequence

>GO660520 ID=GO660520|Name=GO660520|organism=Cicer arietinum|type=EST|length=100bp
TGACTGCGTACCAACGAGTCTTTCATAATCGGGCAGCGAGTCCACTCTCT
CAACGATTCGCGTCGTGTGGGCACCGTGAAATACACTCAGGACTCATCAA
back to top