FE673003

EST Overview
NameFE673003
Unique NameFE673003
TypeEST
OrganismCicer arietinum (chickpea)
Sequence length317
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Cicer arietinum unigene v12010-12-27
InterProScan analysis for Cicer arietinum unigene v12010-12-29
Libraries
Library NameType
LIBEST_022820 Drought-stressed chickpea leave librarycdna_library
Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Cicer arietinum unigene v1Cicer arietinum unigene v1EST
InterPro
Analysis Name: InterProScan analysis for Cicer arietinum unigene v1
Date Performed: 2010-12-29
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 13..41
score
NoneNo IPR availableSEGsegsegcoord: 24..56
score
NoneNo IPR availableSEGsegsegcoord: 7..27
score

Properties
Property NameValue
Singlet in analysisCicer arietinum unigene v1
Sequences
The following sequences are available for this feature:

EST sequence

>FE673003 ID=FE673003|Name=FE673003|organism=Cicer arietinum|type=EST|length=317bp
CCGGGGCTGCAGGAATTCGAACTCGACGATATTGAAACAGTGAAACTGTC
CTGCCCTGCGAAGACGATCTTGAACACGATCCTCAAACTGTCTCGCCTCC
GCCTTCATTAGCTTCGCATCGCGCGCTCCGTCTCGCCTCCGCCTCCGGCT
CAGTTTTGCGTCTCGTCTCTCATCCCTCGTCAAGTCGCCCTCGTCTCAGC
CTTGGTTGGCCGTTCGTCAAAACTCAAAAGGGCTCGTAAGTTTTATCATA
TGGACAATTTACGCCAGCAGAAAATTCAAAAGTATGAAGAGTTTGTTGAT
AAACGTATGAAACCTGA
back to top