HO067242

EST Overview
NameHO067242
Unique NameHO067242
TypeEST
OrganismCicer arietinum (chickpea)
Sequence length443
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Cicer arietinum unigene v12010-12-27
Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Cicer arietinum unigene v1Cicer arietinum unigene v1EST
Properties
Property NameValue
Singlet in analysisCicer arietinum unigene v1
Sequences
The following sequences are available for this feature:

EST sequence

>HO067242 ID=HO067242|Name=HO067242|organism=Cicer arietinum|type=EST|length=443bp
CGGGCAGGTACGCGGGGGTAAATTAAGGATTGAAAAGAAGGGTATGATAG
GAAAATAATTAACTTAAAATAGGTAAATGAGTGTGACAAGTGCTGAATTT
CCATGATCTTATTACAGACGAGGAGGATGCTAAGAAGAACGAGATAACAA
CACATGTGCATGGACAAAATTGTTGGTCAGGATTCAGATAGTATACTTTA
GCAGGTGAATTTTGTATGATACTGTGTATTTGATATACATATCCACATGT
ATCAAGCGGTGAATATTTTTAGGCCATTTTATTCAGCTCATCTTGTACAG
TTGTACTAATTACTAAAAACCACAGAGCCTCTTGCTGATCAAAACGTATT
ACCTAGTTATAGTCCATATACTTAATTATACTTGTGTTTGAGAGTTTTTA
TTACATTGTAACATACAAGAAGATGCAAATCCATAATTAGTTG
back to top