HO067327

EST Overview
NameHO067327
Unique NameHO067327
TypeEST
OrganismCicer arietinum (chickpea)
Sequence length529
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Cicer arietinum unigene v12010-12-27
InterProScan analysis for Cicer arietinum unigene v12010-12-29
Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Cicer arietinum unigene v1Cicer arietinum unigene v1EST
InterPro
Analysis Name: InterProScan analysis for Cicer arietinum unigene v1
Date Performed: 2010-12-29
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 37..48
score: NAcoord: 68..80
score
NoneNo IPR availableSEGsegsegcoord: 69..80
score
NoneNo IPR availableSEGsegsegcoord: 5..22
score

Properties
Property NameValue
Singlet in analysisCicer arietinum unigene v1
Sequences
The following sequences are available for this feature:

EST sequence

>HO067327 ID=HO067327|Name=HO067327|organism=Cicer arietinum|type=EST|length=529bp
CGGGCAGGTACGCGGGGGGCGGCGAAAAAAAGATCCCATAGTTTGTCTCT
GAGAGATTATCGGACTCTGCAACCTCCTCGTGGTGCCGCCTGGAAATCTT
TCTTACTCTTTTGCTGGAGATGGACAGAGCCAGTGCAGAGACGTTTTCCA
GAGGAAGAAAAGACAGAACAGAGGGAGCAAAAGATACAGAGGGAACACAA
GAGGGCAAAAGGGAACTATCGCCCGGCTGGCAGTTCTTCTGGTAACAAAT
TCTCAATCGGCGGACCATTAATCCAGAATGGGGAGTCCCACAACAATTCT
TCCGGTAGGACTGAGATAGCGGGTTCTACACCCAGCGTTGACTCGTGCGC
CGGGCCTTCCCTCCTACGGCCCGTGCTCGGCATGTAAAATGAATAAAATA
AAGCATACGAGGAAAATTTCAAGGGTTGTGAAAATGGTGGACAGGACAGG
TAGACGGAAGACAGGAATCATGAAATGTATCTTTTATCTCAGTATTCTCC
TTTGACTAATCTTTCGCTTGCTTTCTATA
back to top