HO064972

EST Overview
NameHO064972
Unique NameHO064972
TypeEST
OrganismCicer arietinum (chickpea)
Sequence length409
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Cicer arietinum unigene v12010-12-27
InterProScan analysis for Cicer arietinum unigene v12010-12-29
Libraries
Library NameType
LIBEST_026412 Chickpea drought stressed cDNA SSH library AS1cdna_library
Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Cicer arietinum unigene v1Cicer arietinum unigene v1EST
InterPro
Analysis Name: InterProScan analysis for Cicer arietinum unigene v1
Date Performed: 2010-12-29
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 28..33
score: NAcoord: 64..89
score
NoneNo IPR availableSEGsegsegcoord: 40..49
score

Properties
Property NameValue
Singlet in analysisCicer arietinum unigene v1
Sequences
The following sequences are available for this feature:

EST sequence

>HO064972 ID=HO064972|Name=HO064972|organism=Cicer arietinum|type=EST|length=409bp
ACAGATCGNTCCGCAGATGCTCCCTGTGACCTGCCATGGCNGGCCGCTGG
GGGAAAATTCTGACTTATGACTGATGTGATCTGCATGGCCTGAGGTGGTA
CATATAGAGTCCGATTTAACTTGGGTTCGCGGTTTTCCCCAACTTTGAGG
AAGCACATACAGCNAACCGNTAACCCTATTATACCCCCTATATACCTAGC
TTTGGCCCTTTATACCATCCGAGAAGCACTTATTCCCNTACGGGCNTTAA
CCCTTCCAACGCGCGTTNGTTTGGCACTCGGTTCNNAAACAACCATCTCC
AANCGCACAGTGGTTNATACAACCATTTTGGATTTAATCCCNATCAGCNG
CTTACCCTNGCGTATATAGGGCACACCGGGCTAGGTTTATTACCACGACA
CNCGAACAC
back to top