EX568976

EST Overview
NameEX568976
Unique NameEX568976
TypeEST
OrganismPisum sativum (pea)
Sequence length841
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Pisum sativum unigene v12010-12-27
Pisum sativum unigene v22011-03-01
Libraries
Library NameType
LIBEST_021973 Pisum sativum shoot apical meristem ESTscdna_library
Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Pisum sativum unigene v2Pisum sativum unigene v2EST
Pisum sativum unigene v1Pisum sativum unigene v1EST
Properties
Property NameValue
Singlet in analysisPisum sativum unigene v2
Singlet in analysisPisum sativum unigene v1
Sequences
The following sequences are available for this feature:

EST sequence

>EX568976 ID=EX568976|Name=EX568976|organism=Pisum sativum|type=EST|length=841bp
AGAAGGAACCCTTGGAATTTTTGTACAGATGACAAAAGAAGTATATGGAG
ATGATGATACAGTCATAACAAATTTAGACTTCAGGGAACTTGACAATGGA
GAAAGAATAGAGACTTTTATTTATGATTATGGTTGTATAATTACCATACA
AAAGGCTGAGTAATAACTCTTATTCATACTAATACTTGACTCCGAGTTCC
AATCTTGTAGGGCAAAAAATCGTGATAATAATTAAGAAGTATGAAAACAA
TTCTAAGACATAATTCAGATCAAGATATTATAAAATATTTCCTCCGTTTC
AAAATGACTATCGTTTTAGCAAAATAAATTTGTTTCAAAATGAATGTCAT
TTACACTTTTCAACGTAGAAATGGTTGATGTTTTTCCAATTGTATCCTTT
AATTATTATTACTCTGTACATTACTTCTAACACATTAATAAGGTTAATTT
AGTAAAAGTGTAATGTCTTATGACAATATTATTGCATTCCTTAATCTTTG
TGCAAAAACTTTAAACAATAGTCATTTTGAAATAGAGGGAGTAATAGTAT
TAATCATACCTTATCATCTAAGGGCTTTGTTTTCAGTGATATACTAAAAA
TTGTGATAACACTCAGGTCTTTATGGTGAAGTCAAACCTTTAAAAATGTT
GTGATGGTGTGTTTTTTCTCTCAGCATTTGTTTTGTTCCCCTGATACTTA
CAACTTTGGTTTATATTTCTTCTTACATGTTATGCTATATACGTTGACTG
AATTAATTTGGTCTGAATAGTCTGATACTGCAAGTGTACAAGTCCCTGAA
CTTGACTTGGAGCTGGCAAGCGGCACCATGGGAGGACTTGT
back to top