FG534236

EST Overview
NameFG534236
Unique NameFG534236
TypeEST
OrganismPisum sativum (pea)
Sequence length206
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Pisum sativum unigene v12010-12-27
InterProScan analysis for Pisum sativum unigene v12010-12-29
Libraries
Library NameType
LIBEST_023216 MeriT Pisum sativum Shoot apical meristem ESTscdna_library
Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Pisum sativum unigene v1Pisum sativum unigene v1EST
InterPro
Analysis Name: InterProScan analysis for Pisum sativum unigene v1
Date Performed: 2010-12-29
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 31..55
score

Properties
Property NameValue
Singlet in analysisPisum sativum unigene v1
Sequences
The following sequences are available for this feature:

EST sequence

>FG534236 ID=FG534236|Name=FG534236|organism=Pisum sativum|type=EST|length=206bp
TGAAGAAAGTTGCTGCGAAGAAAGTTCCGGTTAAGAGTGTGAAGGCTAAA
AGCGTGAAGTCTCCAGTGAAAAAGGTTTCTGTCAAGAGAGGTGGAAGGAA
ATGAGAGTTTAGATTAGATGTTGTAAAGATCTCTACGTTTTCTGACGTAG
TTTTTTGTATTAGTTTTTAATAACGTTTTTATAATACATATTATTTTCCG
TTTAAN
back to top