GH719933

EST Overview
NameGH719933
Unique NameGH719933
TypeEST
OrganismPisum sativum (pea)
Sequence length317
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Pisum sativum unigene v12010-12-27
InterProScan analysis for Pisum sativum unigene v12010-12-29
Libraries
Library NameType
LIBEST_024269 TNIcdna_library
Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Pisum sativum unigene v1Pisum sativum unigene v1EST
InterPro
Analysis Name: InterProScan analysis for Pisum sativum unigene v1
Date Performed: 2010-12-29
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 22..36
score
NoneNo IPR availableSEGsegsegcoord: 24..38
score

Properties
Property NameValue
Singlet in analysisPisum sativum unigene v1
Sequences
The following sequences are available for this feature:

EST sequence

>GH719933 ID=GH719933|Name=GH719933|organism=Pisum sativum|type=EST|length=317bp
TGGATTGTAAATTATTTGTTGCTATAGGAAATATAAAAATATCTTCCTGC
CAAAGGAAGAGGGTCTTACATGACTGAGATGATGAACTGATGAATTCGAG
AAAGGAGCTTAGTGACCCCTTTTGCCGGAGACAAGTTATTTTAGGTGCAG
CCTTGTGTTGTAGATTTGGCTGCTTAATGGTGTGTTATTTGCTGATCCTG
GTAACTGGTTGTATTGCTATTCCGATTTCTTGGTTGTATTATTACTTTTC
GATTTTGCTATGTTTGTATTGTCATGTAATAAATCTTGTGATTTTGGTAA
AGGTCTTTTCTGTTTGT
back to top