GH720493

EST Overview
NameGH720493
Unique NameGH720493
TypeEST
OrganismPisum sativum (pea)
Sequence length309
Libraries
Library NameType
LIBEST_024271 552NIcdna_library
Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Pisum sativum unigene v2Pisum sativum unigene v2EST
Pisum sativum unigene v1Pisum sativum unigene v1EST
Homology
BLAST of GH720493 vs. SwissProt
Match: RL8_SOLLC (60S ribosomal protein L8 OS=Solanum lycopersicum GN=RPL8 PE=2 SV=1)

HSP 1 Score: 55.0694 bits (131), Expect = 1.334e-7
Identity = 28/36 (77.78%), Postives = 29/36 (80.56%), Query Frame = -3
Query:  182 TVRRDAPPGQKVGLIAAKRTGRLRGQXXXXXXXADK 289
            TVRRDAPPGQKVGLIAA+RTGRLRGQ       ADK
Sbjct:  224 TVRRDAPPGQKVGLIAARRTGRLRGQARATAAKADK 259          
BLAST of GH720493 vs. SwissProt
Match: RL81_ARATH (60S ribosomal protein L8-1 OS=Arabidopsis thaliana GN=RPL8A PE=2 SV=2)

HSP 1 Score: 53.9138 bits (128), Expect = 2.972e-7
Identity = 25/26 (96.15%), Postives = 26/26 (100.00%), Query Frame = -3
Query:  212 TVRRDAPPGQKVGLIAAKRTGRLRGQ 289
            TVRRDAPPGQKVGLIAA+RTGRLRGQ
Sbjct:  224 TVRRDAPPGQKVGLIAARRTGRLRGQ 249          
BLAST of GH720493 vs. SwissProt
Match: RL83_ARATH (60S ribosomal protein L8-3 OS=Arabidopsis thaliana GN=RPL8C PE=2 SV=2)

HSP 1 Score: 52.373 bits (124), Expect = 8.646e-7
Identity = 24/26 (92.31%), Postives = 26/26 (100.00%), Query Frame = -3
Query:  212 TVRRDAPPGQKVGLIAAKRTGRLRGQ 289
            TVRRDAPPG+KVGLIAA+RTGRLRGQ
Sbjct:  224 TVRRDAPPGKKVGLIAARRTGRLRGQ 249          
BLAST of GH720493 vs. TAIR peptide
Match: AT2G18020.1 (| Symbols: EMB2296 | Ribosomal protein L2 family | chr2:7837151-7838160 FORWARD LENGTH=258)

HSP 1 Score: 53.9138 bits (128), Expect = 2.344e-8
Identity = 25/26 (96.15%), Postives = 26/26 (100.00%), Query Frame = -3
Query:  212 TVRRDAPPGQKVGLIAAKRTGRLRGQ 289
            TVRRDAPPGQKVGLIAA+RTGRLRGQ
Sbjct:  224 TVRRDAPPGQKVGLIAARRTGRLRGQ 249          
BLAST of GH720493 vs. TAIR peptide
Match: AT4G36130.1 (| Symbols: | Ribosomal protein L2 family | chr4:17097613-17098656 FORWARD LENGTH=258)

HSP 1 Score: 52.373 bits (124), Expect = 6.821e-8
Identity = 24/26 (92.31%), Postives = 26/26 (100.00%), Query Frame = -3
Query:  212 TVRRDAPPGQKVGLIAAKRTGRLRGQ 289
            TVRRDAPPG+KVGLIAA+RTGRLRGQ
Sbjct:  224 TVRRDAPPGKKVGLIAARRTGRLRGQ 249          
BLAST of GH720493 vs. TAIR peptide
Match: AT2G18020.1 (| Symbols: EMB2296 | Ribosomal protein L2 family | chr2:7837151-7838160 FORWARD LENGTH=258)

HSP 1 Score: 53.9138 bits (128), Expect = 2.344e-8
Identity = 25/26 (96.15%), Postives = 26/26 (100.00%), Query Frame = -3
Query:  212 TVRRDAPPGQKVGLIAAKRTGRLRGQ 289
            TVRRDAPPGQKVGLIAA+RTGRLRGQ
Sbjct:  224 TVRRDAPPGQKVGLIAARRTGRLRGQ 249          
BLAST of GH720493 vs. TAIR peptide
Match: AT4G36130.1 (| Symbols: | Ribosomal protein L2 family | chr4:17097613-17098656 FORWARD LENGTH=258)

HSP 1 Score: 52.373 bits (124), Expect = 6.821e-8
Identity = 24/26 (92.31%), Postives = 26/26 (100.00%), Query Frame = -3
Query:  212 TVRRDAPPGQKVGLIAAKRTGRLRGQ 289
            TVRRDAPPG+KVGLIAA+RTGRLRGQ
Sbjct:  224 TVRRDAPPGKKVGLIAARRTGRLRGQ 249          
BLAST of GH720493 vs. Lotus protein
Match: LjT43K17.90.r2.a (- phase: 0 )

HSP 1 Score: 56.225 bits (134), Expect = 3.230e-9
Identity = 29/36 (80.56%), Postives = 29/36 (80.56%), Query Frame = -3
Query:  182 TVRRDAPPGQKVGLIAAKRTGRLRGQXXXXXXXADK 289
            TVRRDAPPGQKVGLIAAKRTGRLRGQ       ADK
Sbjct:  224 TVRRDAPPGQKVGLIAAKRTGRLRGQAAATAAKADK 259          
BLAST of GH720493 vs. Lotus protein
Match: chr1.CM0284.670.r2.d (+ phase: 0 )

HSP 1 Score: 56.225 bits (134), Expect = 3.230e-9
Identity = 29/36 (80.56%), Postives = 29/36 (80.56%), Query Frame = -3
Query:  182 TVRRDAPPGQKVGLIAAKRTGRLRGQXXXXXXXADK 289
            TVRRDAPPGQKVGLIAAKRTGRLRGQ       ADK
Sbjct:  224 TVRRDAPPGQKVGLIAAKRTGRLRGQAAATAAKADK 259          
BLAST of GH720493 vs. Lotus protein
Match: chr2.CM0249.280.r2.d (+ phase: 2 /partial)

HSP 1 Score: 56.225 bits (134), Expect = 3.230e-9
Identity = 29/36 (80.56%), Postives = 29/36 (80.56%), Query Frame = -3
Query:  182 TVRRDAPPGQKVGLIAAKRTGRLRGQXXXXXXXADK 289
            TVRRDAPPGQKVGLIAAKRTGRLRGQ       ADK
Sbjct:  122 TVRRDAPPGQKVGLIAAKRTGRLRGQAAATAAKADK 157          
BLAST of GH720493 vs. Lotus protein
Match: chr4.CM0119.50.r2.d (- phase: 0 )

HSP 1 Score: 56.225 bits (134), Expect = 3.230e-9
Identity = 29/36 (80.56%), Postives = 29/36 (80.56%), Query Frame = -3
Query:  182 TVRRDAPPGQKVGLIAAKRTGRLRGQXXXXXXXADK 289
            TVRRDAPPGQKVGLIAAKRTGRLRGQ       ADK
Sbjct:  224 TVRRDAPPGQKVGLIAAKRTGRLRGQAAATAAKADK 259          
BLAST of GH720493 vs. Soybean peptides
Match: Glyma16g24120.1|PACid:16302717 ()

HSP 1 Score: 55.0694 bits (131), Expect = 1.648e-8
Identity = 28/36 (77.78%), Postives = 29/36 (80.56%), Query Frame = -3
Query:  182 TVRRDAPPGQKVGLIAAKRTGRLRGQXXXXXXXADK 289
            TVRRDAPPGQKVGLIAA+RTGRLRGQ       ADK
Sbjct:  224 TVRRDAPPGQKVGLIAARRTGRLRGQAAATAAKADK 259          
BLAST of GH720493 vs. Soybean peptides
Match: Glyma11g08050.1|PACid:16283084 ()

HSP 1 Score: 55.0694 bits (131), Expect = 1.648e-8
Identity = 28/36 (77.78%), Postives = 29/36 (80.56%), Query Frame = -3
Query:  182 TVRRDAPPGQKVGLIAAKRTGRLRGQXXXXXXXADK 289
            TVRRDAPPGQKVGLIAA+RTGRLRGQ       ADK
Sbjct:  224 TVRRDAPPGQKVGLIAARRTGRLRGQAAATAAKADK 259          
BLAST of GH720493 vs. Soybean peptides
Match: Glyma02g05540.1|PACid:16247083 ()

HSP 1 Score: 55.0694 bits (131), Expect = 1.648e-8
Identity = 28/36 (77.78%), Postives = 29/36 (80.56%), Query Frame = -3
Query:  182 TVRRDAPPGQKVGLIAAKRTGRLRGQXXXXXXXADK 289
            TVRRDAPPGQKVGLIAA+RTGRLRGQ       ADK
Sbjct:  224 TVRRDAPPGQKVGLIAARRTGRLRGQAAATAAKADK 259          
BLAST of GH720493 vs. Soybean peptides
Match: Glyma01g37250.1|PACid:16245458 ()

HSP 1 Score: 55.0694 bits (131), Expect = 1.648e-8
Identity = 28/36 (77.78%), Postives = 29/36 (80.56%), Query Frame = -3
Query:  182 TVRRDAPPGQKVGLIAAKRTGRLRGQXXXXXXXADK 289
            TVRRDAPPGQKVGLIAA+RTGRLRGQ       ADK
Sbjct:  224 TVRRDAPPGQKVGLIAARRTGRLRGQAAATAAKADK 259          
BLAST of GH720493 vs. SwissProt
Match: RL8_SOLLC (60S ribosomal protein L8 OS=Solanum lycopersicum GN=RPL8 PE=2 SV=1)

HSP 1 Score: 55.0694 bits (131), Expect = 1.357e-7
Identity = 28/36 (77.78%), Postives = 29/36 (80.56%), Query Frame = -3
Query:  182 TVRRDAPPGQKVGLIAAKRTGRLRGQXXXXXXXADK 289
            TVRRDAPPGQKVGLIAA+RTGRLRGQ       ADK
Sbjct:  224 TVRRDAPPGQKVGLIAARRTGRLRGQARATAAKADK 259          
BLAST of GH720493 vs. SwissProt
Match: RL81_ARATH (60S ribosomal protein L8-1 OS=Arabidopsis thaliana GN=RPL8A PE=1 SV=2)

HSP 1 Score: 53.9138 bits (128), Expect = 3.024e-7
Identity = 25/26 (96.15%), Postives = 26/26 (100.00%), Query Frame = -3
Query:  212 TVRRDAPPGQKVGLIAAKRTGRLRGQ 289
            TVRRDAPPGQKVGLIAA+RTGRLRGQ
Sbjct:  224 TVRRDAPPGQKVGLIAARRTGRLRGQ 249          
BLAST of GH720493 vs. SwissProt
Match: RL83_ARATH (60S ribosomal protein L8-3 OS=Arabidopsis thaliana GN=RPL8C PE=1 SV=2)

HSP 1 Score: 52.373 bits (124), Expect = 8.799e-7
Identity = 24/26 (92.31%), Postives = 26/26 (100.00%), Query Frame = -3
Query:  212 TVRRDAPPGQKVGLIAAKRTGRLRGQ 289
            TVRRDAPPG+KVGLIAA+RTGRLRGQ
Sbjct:  224 TVRRDAPPGKKVGLIAARRTGRLRGQ 249          
BLAST of GH720493 vs. Medicago proteins
Match: IMGA|Medtr7g076940.1 (60S ribosomal protein L2 (AHRD V1 ***- B6TGT0_MAIZE); contains Interpro domain(s) IPR002171 Ribosomal protein L2 chr07_pseudomolecule_IMGAG_V3.5 21247962-21249644 F EGN_Mt100125 20100825)

HSP 1 Score: 56.225 bits (134), Expect = 4.525e-9
Identity = 29/36 (80.56%), Postives = 29/36 (80.56%), Query Frame = -3
Query:  182 TVRRDAPPGQKVGLIAAKRTGRLRGQXXXXXXXADK 289
            TVRRDAPPGQKVGLIAAKRTGRLRGQ       ADK
Sbjct:  224 TVRRDAPPGQKVGLIAAKRTGRLRGQAAASAAKADK 259          
BLAST of GH720493 vs. Medicago proteins
Match: IMGA|Medtr5g021800.1 (60S ribosomal protein L2 (AHRD V1 ***- B6TGT0_MAIZE); contains Interpro domain(s) IPR002171 Ribosomal protein L2 chr05_pseudomolecule_IMGAG_V3.5 8236299-8234206 F EGN_Mt100125 20100825)

HSP 1 Score: 55.0694 bits (131), Expect = 1.008e-8
Identity = 26/26 (100.00%), Postives = 26/26 (100.00%), Query Frame = -3
Query:  212 TVRRDAPPGQKVGLIAAKRTGRLRGQ 289
            TVRRDAPPGQKVGLIAAKRTGRLRGQ
Sbjct:  224 TVRRDAPPGQKVGLIAAKRTGRLRGQ 249          
The following BLAST results are available for this feature:
BLAST of GH720493 vs. SwissProt
Analysis Date: 2010-12-28 (Homology Analysis: Pisum sativum unigene v1 vs Swissprot)
Total hits: 3
Match NameE-valueIdentityDescription
RL8_SOLLC1.334e-777.7860S ribosomal protein L8 OS=Solanum lycopersicum G... [more]
RL81_ARATH2.972e-796.1560S ribosomal protein L8-1 OS=Arabidopsis thaliana... [more]
RL83_ARATH8.646e-792.3160S ribosomal protein L8-3 OS=Arabidopsis thaliana... [more]
back to top
BLAST of GH720493 vs. TAIR peptide
Analysis Date: 2011-02-03 (Homology Analysis: Pisum sativum unigene v1 vs TAIR 10 peptide)
Total hits: 2
Match NameE-valueIdentityDescription
AT2G18020.12.344e-896.15| Symbols: EMB2296 | Ribosomal protein L2 family |... [more]
AT4G36130.16.821e-892.31| Symbols: | Ribosomal protein L2 family | chr4:1... [more]
back to top
BLAST of GH720493 vs. TAIR peptide
Analysis Date: 2011-04-21 (Homology Analysis: Pisum sativum unigene v2 vs TAIR 10 peptide)
Total hits: 2
Match NameE-valueIdentityDescription
AT2G18020.12.344e-896.15| Symbols: EMB2296 | Ribosomal protein L2 family |... [more]
AT4G36130.16.821e-892.31| Symbols: | Ribosomal protein L2 family | chr4:1... [more]
back to top
BLAST of GH720493 vs. Lotus protein
Analysis Date: 2011-04-21 (Homology Analysis: Pisum sativum unigene v2 vs Lotus proteins)
Total hits: 4
Match NameE-valueIdentityDescription
LjT43K17.90.r2.a3.230e-980.56- phase: 0 [more]
chr1.CM0284.670.r2.d3.230e-980.56+ phase: 0 [more]
chr2.CM0249.280.r2.d3.230e-980.56+ phase: 2 /partial[more]
chr4.CM0119.50.r2.d3.230e-980.56- phase: 0 [more]
back to top
BLAST of GH720493 vs. Soybean peptides
Analysis Date: 2011-04-21 (Homology Analysis: Pisum sativum unigene v2 vs Soybean peptides)
Total hits: 4
Match NameE-valueIdentityDescription
Glyma16g24120.1|PACid:163027171.648e-877.78[more]
Glyma11g08050.1|PACid:162830841.648e-877.78[more]
Glyma02g05540.1|PACid:162470831.648e-877.78[more]
Glyma01g37250.1|PACid:162454581.648e-877.78[more]
back to top
BLAST of GH720493 vs. SwissProt
Analysis Date: 2011-04-21 (Homology Analysis: Pisum sativum unigene v2 vs Swissprot)
Total hits: 3
Match NameE-valueIdentityDescription
RL8_SOLLC1.357e-777.7860S ribosomal protein L8 OS=Solanum lycopersicum G... [more]
RL81_ARATH3.024e-796.1560S ribosomal protein L8-1 OS=Arabidopsis thaliana... [more]
RL83_ARATH8.799e-792.3160S ribosomal protein L8-3 OS=Arabidopsis thaliana... [more]
back to top
BLAST of GH720493 vs. Medicago proteins
Analysis Date: 2011-04-21 (Homology Analysis: Pisum sativum unigene v2 vs Medicago proteins)
Total hits: 2
Match NameE-valueIdentityDescription
IMGA|Medtr7g076940.14.525e-980.5660S ribosomal protein L2 (AHRD V1 ***- B6TGT0_MAIZ... [more]
IMGA|Medtr5g021800.11.008e-8100.0060S ribosomal protein L2 (AHRD V1 ***- B6TGT0_MAIZ... [more]
back to top
InterPro
Analysis Name: InterProScan analysis for Pisum sativum unigene v2
Date Performed: 2011-04-27
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 10..24
score: NAcoord: 32..44
score

Analysis Name: InterProScan analysis for Pisum sativum unigene v1
Date Performed: 2010-12-29
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 10..24
score: NAcoord: 32..44
score

Properties
Property NameValue
Singlet in analysisPisum sativum unigene v2
Singlet in analysisPisum sativum unigene v1
Sequences
The following sequences are available for this feature:

EST sequence

>GH720493 ID=GH720493|Name=GH720493|organism=Pisum sativum|type=EST|length=309bp
AGGCCATCAAAAACATATAATTAATCTGAAGTAGAGAATAAAGATGCAAC
CATAACAAGCTGTCTAAGAAAAACTCCATAACTTCTAGGAAATAGTTCTC
AAAACAAAAACAGAAATAGTTCTCAAAACAAAATTGTAACGCAAGCAAAT
AATATATAATTCAAACAATCTAAACTTCTTATTTGTCGGCCTTGGCAGCA
CTTGCAGCAGCTTGACCCCTGAGTCGCCCAGTCCTCTTGGCAGCAATGAG
ACCAACCTTCTGTCCAGGAGGTGCATCACGTCTGACAGTACCTCGGCCGC
GACCACGCT
back to top