DR749503

EST Overview
NameDR749503
Unique NameDR749503
TypeEST
OrganismCicer arietinum (chickpea)
Sequence length478
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Cicer arietinum unigene v12010-12-27
Relationships

This EST is a part of the following contig feature(s):

Feature NameUnique NameSpeciesType
Cicer_arietinum_v1_Contig110Cicer_arietinum_v1_Contig110Cicer arietinumcontig


Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Cicer arietinum unigene v1Cicer arietinum unigene v1EST
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Cicer_arietinum_v1_Contig110contigCicer_arietinum_v1_Contig110:554..1031 +
Sequences
The following sequences are available for this feature:

EST sequence

>DR749503 ID=DR749503|Name=DR749503|organism=Cicer arietinum|type=EST|length=478bp
CATCTACGCCGATTAACCGTCATAACTTCATCCGGTTCCCCAACCATAAT
TTCCGGCGACATACCCGCTTCTCCCATGCTTTTTGCATACTCTGATCTCG
ACCGTTCATCAGGTACTATGCACACGTGTCTTCCACACGTTTGGCGACTC
GCTATGGCTAAACCCACACTCGTTGGGATAACTCCGCCACGTGACCATGT
TTCCACTATAAGCTGCGCGTTCCATCCCGCTGCCATAGCAGATACTAGCT
CCGCCACTCCAGATTCATTGAAAATCTCACAAGCTTGCACTGTGTGGATG
TATGCGTTACTTGCTTTATCTGGGGACCAAACTAGTTTCATTCCTTTCAT
GCTATGTTATAAAGTTTCTTTATGTTGTGTTGTGTTGAGAAGATTGGTGT
GGGTGTATGTGTGTTCTTTTTCCCTTCATAATTGTTCCATCGATACTTGG
ATCCTTTCTGATCTTTACTTATACATGC
back to top